Skip to content
This repository was archived by the owner on Aug 29, 2025. It is now read-only.

plotly/fornac

 
 

Repository files navigation

FornaContainer

In many situations, the user interaction is superfluous and the desired goal is to simply display a secondary structure on a web page. This is a common scenario in, for example, servers that predict a secondary structure. The output, a dot-bracket string can simply be added to a FornaContainer object to display.

Trivial Example

Below is an example of a simple web page which uses a FornaContainer to show a simple RNA molecule:

blah blah

The code for creating this web page is rather straightforward. After importing some necessary javascript files, we create a container using new FornaContainer("#rna_ss", {'applyForce': false}), passing in #rna_ss as the id of the div which will hold the container and then populate it with a structure and sequence using container.addRNA:

<!DOCTYPE html>
<meta charset="utf-8">

This is an RNA container.
<div id='rna_ss'> </div>
This after the RNA container.

    <link rel='stylesheet' type='text/css' href='styles/fornac.css' />
    <script type='text/javascript' src='scripts/fornac.js'></script>
    <script type='text/javascript'>
        var container = new FornaContainer("#rna_ss", {'applyForce': false});

        var options = {'structure': '((..((....)).(((....))).))',
                        'sequence': 'CGCUUCAUAUAAUCCUAAUGACCUAU'
        };

        container.addRNA(options.structure, options);
    </script>

Cofolded sequences

Display two cofolded sequences using the format of RNAcofold:

Cofolded sequences

    var container = new fornac.FornaContainer("#cofold_ss",
            {'applyForce': false, 'allowPanningAndZooming': true, 'initialSize':[500,300]});
                                                     
    var options = {'structure': '..((((...))))...((...((...((..&............))...))...))..',
        'sequence': 'ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG'
    };                                                                                     
    container.addRNA(options.structure, options);
    container.setSize(); 

Options

The FornaContainer supports a number of options to allow users to customize how the RNA will be presented.

applyForce

Indicate whether the force-directed layout will be applied to the displayed molecule. Enabling this option allows users to change the layout of the molecule by selecting and dragging the individual nucleotide nodes

allowPanningAndZooming [default=true]

Allow users to zoom in and pan the display. If this is enabled then pressing the 'c' key on the keyboard will center the view.

circularizeExternal [default=true]

This only makes sense in connection with the applyForce argument. If it's true, the external loops will be arranged in a nice circle. If false, they will be allowed to flop around as the force layout dictates:

labelInterval [default=10]

Change how often nucleotide numbers are labelled with their number.

Implementation

Each RNA molecule is represented as a JSON file which encodes all of the information necessary to display it. The example shows a trivial and slightly modified example. nodeType can be either nucleotide or label or middle, the latter of which is used only as a placeholder for maintaining an aesthetically pleasing layout.

The links can be any of basepair (representing a basepair between two nucleotides), backbone (backbone bond between adjacent nodes), pseudoknot (pseudoknot, extracted from the specified structure using maximum matching algorithm), extra (extra links specified by the user), label_link (links between nucleotides and their nucleotide number labels), fake (invisible links for maintaining the layout), and fake_fake (invisible links for maintaining the layout).

This structure is initially created in rnagraph.js starting from a sequence and dotbracket string.

{
  "nodes": 
    [ {
      "name": "A",
      "num": 1,
      "radius": 5,
      "rna": null,
      "nodeType": "nucleotide",
      "structName": "empty",
      "elemType": "e",
      "uid": "44edb966-aca9-4058-a6bc-784a34959329",
      "linked": false,
      "prevNode": null,
      "nextNode": null,
      "x": 100,
      "px": 100,
      "y": 100,
      "py": 100
    },
    ...
    ],
  "links": 
    [ {
      "source": null,
      "target": null,
      "linkType": "basepair",
      "value": 1,
      "uid": "6664a569-5af1-4d86-8ada-d1c00da72a899f87a224-52a0-4ede-a29c-04fddc09e4c4"
      },
      ...
    ]
}

Development

First:

npm install
bower install

To debug:

gulp serve

To build:

gulp build

The output will be placed in the dist directory. To use fornac in a web page, simply include dist/scripts/fornac.js in your web page.

Acknowledgements

Thanks to Benedikt Rauscher for the Javascript version of the NAView layout and to the creators of VARNA for the java implementation that it's based on.

About

A container for the forna visualization software.

Resources

License

Stars

0 stars

Watchers

0 watching

Forks

Packages

 
 
 

Contributors

Languages

  • JavaScript 91.6%
  • HTML 5.6%
  • CSS 2.8%